mammalian

share

Examples
mammalian's examples

  • Mammalian definition, an animal of the class Mammalia; mammal. mammalian - 3 dictionary results. Mammalian Expression. Transient and Stable Cell Line Expression. High Purity and Soluble. . Free Toolbar. — “Mammalian | Define Mammalian at ”,
  • Red filled branches indicate clades of viruses (Mononegavirales), black filled branches indicate mammalian sequences, and blue filled lines indicate expressed sequence tags. Geographic origins are given in black filled branches indicate mammalian sequences, and blue filled lines. — “BioMed Central | Full text | Filoviruses are ancient and”,
  • Mammalian cell lines are used in the production of complex therapeutic proteins. CHO cell lines are the most commonly employed mammalian cell line and Cygnus offers three different ELISA kits for CHO HCP quantitation. — “Cygnus Technologies - Mammalian”,
  • For the greater part of 150 years it was assumed that the mammalian retina contained only two types of photoreceptors; rods and cones. The mammalian image-forming visual system is capable of operating over a wide spectrum of ambient light intensities covering more than ten orders of magnitude. — “Webvision: Melanopsin ganglion cells”, webvision.med.utah.edu
  • Although they were preceded by many diverse groups of non-mammalian synapsids (sometimes misleadingly referred to as mammal-like reptiles), the to true mammal status — it had a mammalian jaw joint (formed by the dentary and squamosal. — “Mammal - Wikipedia, the free encyclopedia”,
  • Non-Mammalian Models of Human Cancers Subgroup Recommendations Recommendation 3. Support the establishment and maintenance of organism-specific databases for appropriate non-mammalian organisms and support the development of a pan-organism database or of software allowing. — “NCIDEA: Preclinical Models for Human Cancers Working Group”, deainfo.nci.nih.gov
  • Microbiology question: What are mammalian cells? Mammals including human are made up of very small cells called mammalian cells .These differ from plant cells by not having cell wall These are bounded. — “ - What are mammalian cells”,
  • All three vector systems are designed specifically for high-level expression of gene products in mammalian cells. The demand for versatile mammalian expression vectors is growing, since many researchers study eukaryotic gene transcription and translation. — “Versatile Mammalian Expression Vectors: A Review - Biocompare”,
  • 13: 13.6 Cell-Cycle Control in Mammalian Cells. In multicellular organisms, precise control of the cell cycle during development Like S. cerevisiae, mammalian cells express multiple cyclins. — “13.6 Cell-Cycle Control in Mammalian Cells -- Molecular Cell”, m.nih.gov
  • Definition of mammalian in the Medical Dictionary. mammalian explanation. Information about mammalian in Free online English dictionary. What is mammalian? Meaning of mammalian medical term. What does mammalian mean?. — “mammalian - definition of mammalian in the Medical dictionary”, medical-
  • Mammalian Species is published regularly by the American Society of Mammalogists with 25-30 accounts issued each year, each summarizing the current understanding of the biology of a single species, including systematics, distribution, fossil. — “Index for Mammalian Species - Virginia Hayssen”, science.smith.edu
  • Although they were preceded by many diverse groups of non-mammalian synapsids (sometimes misleadingly referred to as mammal-like reptiles), the to true mammal status — it had a mammalian jaw joint (formed by the dentary and squamosal. — “mammal: Definition from ”,
  • By considering the structures of the non-mammalian and mammalian vertebrate brains, we will see how it can be In the non-mammalian vertebrate brain, as we have seen, the three subsystems serving the three subfunctions of the animal behavior guidance system are distributed to. — “The origin and detailed structure of the mammalian brain”,
  • Marsupials and eutherians reunited: genetic evidence for the Theria hypothesis of mammalian evolution. Mammalian evolution: Timing and implications from using the LogDeterminant transform for. — “Mammalia”,
  • Whatever the reason, this terminology ties mammals to a feature that is connected to a key mammalian characteristic: parental behavior. This transition is evidence of mammalian evolution from reptilian beginnings: from a single ear bone, and several lower jaw bones (for example. — “Mammal - New World Encyclopedia”,
  • The pCI-neo Mammalian Expression Vector carries the human cytomegalovirus (CMV) immediate-early enhancer/promoter region to promote constitutive expression of cloned DNA This vector also contains the neomycin phosphotransferase gene, a selectable marker for mammalian cells. — “pCI-neo Mammalian Expression Vector”,
  • Pronunciation of mammalian. Translations of mammalian. mammalian synonyms, mammalian antonyms. Information about mammalian in the free online English dictionary and mammalian - any warm-blooded vertebrate having the skin more or less covered with hair; young are born alive except for the small. — “mammalian - definition of mammalian by the Free Online”,
  • The FreeStyle™ 293 Expression Service rapidly provides you with large amounts of functional mammalian recombinant proteins. We offer the following services to help you with your mammalian protein expression needs:. — “Mammalian”,
  • Here, we present a global evolutionary ***ysis of mammalian conserved mammalian species internal to the spanned species tree. We show that ultraconserved-like. — “Dispensability of mammalian DNA”, bejerano.stanford.edu
  • However, the existence of histidine kinases in mammalian cells has been addition, with the exception of NDP kinase, other mammalian histidine kinases remain to be identified and characterised. — “Mammalian histidine kinases”, bmb.uga.edu
  • Mammalian Phenotype Browser. Search the Mammalian Phenotype Ontology Please contact us with any other questions about the Mammalian Phenotype Ontology. — “MGI_4.4 - Mammalian Phenotype Browser”,
  • pEXP1-DEST (Expressway in vitro) - Vendor:Invitrogen; Vector Type: In vitro; Sequencing Primer: T7 Fwd; Sequencing Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'; Tag: 6X His, Xpress (Nterm); Bacteria Resistance: N/a; Mammalian Selection: Zeocin; Catalog Number: V96001. — “Mammalian Plasmids”,

Images
related images for mammalian

  • Figure 6 Comparison of the ratio of pulse label to total label for exponential and linear patterns of mass increase as described in Table 1 Figure 7 Diagram of patterns of DNA replication during the division cycle in bacteria The different patterns go from an infinite
  • have perceived light etc Here is a schematic of the mammalian circadian clock Genes called Period Cryptochrome Clock and Bmal or MOP are the core clock genes in the mammals It is similar in other organisms with some changes and you can also watch a great
  • Image Core Facility Image Gallery Click on images to enlarge Cultured Mammalian Cells
  • green m3 png
  • polarization is lost The Na+ glucose symporters and IGF receptors become randomly distributed and keratin is replaced by vimentin The cells become de differentiated back to top FIG 14 2 Examples of D rosophila phenotypes due to mutations in the Wnt pathway In the wild type fl y actin which forms a single hair polymerizes in a defi ned position with uniform
  • Click image to enlarge
  • Mammalian Heart
  • chance fluctuations mrna mammalian gif
  • BIOLOGY 197 Principles of Modern Biology II University of Nevada Las Vegas Summer Session III
  • >
  • >
  • >
  • image003 jpg
  • 1195330634 preart animalheaven3 jpg
  • green pc 12 png
  • A spring party 2008 Hiiragi lab members Nov 2007 Barbeque Party Sept 2007
  • >
  • green he la png
  • Mammalian ancestral karyotype 2n=46 Numbers refer to humans
  • have been reported supporting an important role for each of these pigments it is likely that both are involved playing specific yet somewhat overlapping roles in non visual photoreception Image Mammalian Retina The output of the clock is coupled to various effector areas of the brain including other areas of the hypothalamus as well as to the superior cervical ganglia
  • that is contiguous with the spinal cord Comparative neuroanatomy is the branch of neuroscience that searches for the rules behind such organized diversity which results from evolution Regarding the diversity in brain size an unspoken assumption in the field has been that the same scaling rules apply to all mammalian brains that is that large brains were presumed to be
  • >
  • and transports carbon dioxide away from the cells along with toxins Carbon dioxide is expelled from the blood via the lungs while toxins are cleansed from the blood via the kidneys Figure 2 Blood circulation in the human body The image is as if the person is looking at you so the left side of the heart is to the right and visa versa The left side of the heart
  • GO ortho3 jpg
  • The carnassial pair evolved from the P4 M1 combination But it is more accurate to say Carnivorous mammals evolved from insectivorous ancestors The carnassial pair is adapted for slicing meat
  • the faster a cell grows the earlier in the cell cycle the cell achieves a size of 1 0 This accounts for the result that the slower cell has a smaller cell size than the faster growing cell Figure 10 Comparison of shift up of bacterial cells and mammalian cells In the panel a after a shift of bacterial cells from slow growth
  • cell number pattern also changing slowly over a period of time will give a longer period of change in cell size Conlon and Raff observed this slow pattern of mammalian cell size change Figure 11 Age size structure of a growing culture Panel a is the age size structure for a perfectly deterministic population growing
  • barbara lab jpg
  • in panels c and d linear cell increase note the different ordinate scale compared to panels a and b can also lead to cell size maintenance as cells divide at the same size 2 0
  • 1600 1200 1280 960 1152 864 1024 768 800 600
  • >
  • びわ 初物♪でももう時期は終わりだそうです びわは時期が短いからいつものがしちゃうんよね
  • 0 0 and moving through the cell cycle at one tenth of an age each pattern in panel c the incorporation noted by the numbers to the right of the diagrams panel c shows a peaked pattern Figure 6 Comparison of the ratio of pulse label to total label for exponential and linear patterns of mass increase as described in Table 1
  • >
  • にこちゃん これもラブリーじゃ
  • Pichia pastoris Expression System Development of novel materials and systems for biological assays
  • 390x300 800x600 1024x768 1600x1200 Share This Palette Badge
  • primates had smaller brains and a smaller somatosensory cortex to body weight than later primates from prosimiams lemurs to monkeys to apes to humans Figure 1 Kaas 2004 Figure 1 Mammalian brain size Modified from Kaas 2005 The human brain has evolved from the much simpler brain of the early vertebrates which first appeared 400
  • 1600 1200 1280 960 1152 864 1024 768 800 600
  • Selected Publications

Videos
related videos for mammalian

  • Rentschler Biotechnologie: scope and ability in mammalian cells Fintan Walton talks to klaus Schoep, Senior Vice President Client Relations about Rentschler's scope and ability in mammalian cells and the advantages of being a CMO in Biologics
  • ABBE MAY-Mammalian Locomotion (Kevin Parker & Cam Avery Remix) Mammalian Locomotion (Tame Impala) remix. The scrap meat. video made with spare parts by TKT (unofficial video)
  • Mammals Vs. Dinos- Oldest Mammal Fossil On the Science Channel's "Mammals vs. Dinos," paleontologist, Adrian Hunt discovered adelobasileus, the oldest known mammalian fossil in the Chinle Formation. Adelobasileus is thought to be the common ancestor of mammals and lived 200 million years ago.
  • Patricia Churchland - Morality and the Mammalian Brain Self-caring neural circuitry embodies self-preservation values, and these are values in the most elemental sense. Whence caring for others? Social problem-solving, including policy-making, is probably an instance of problem-solving more generally, and draws upon the capacity, prodigious in humans, to envision consequences of a planned action. In humans, it also draws upon the capacity for improving upon current practices and technologies. Unlike other mammals, humans have developed highly complex language, and highly complex cultures. This means that our sociality, and consequently ours systems of ethical values, have become correspondingly complex. Professor Patricia Smith Churchland is a Professor of Philosophy at the University of California, San Diego, and an adjunct Professor at the Salk Institute. Her current work focuses on morality and the social brain. She has been President of the American Philosophical Association and the Society for Philosophy and Psychology, and won a MacArthur Prize in 1991 and the Rossi Prize in 2008.
  • Hitler and the mammalian menace ...menace? Thanks to HapeKax for the initial idea!
  • Spore - Swimming Tutorial (Mammals) How to make swimming creatures in Spore - Animated like a dolphin, whale, or any other mammalian swimmer. The coloured parts and extra tabs are from Davo's Dark Injections mod - They are not necessary for this creation -
  • Mammalian Murder Mystery Did a wolf viciously murder a 22-year-old? Or was it a bear? Canadian authorities attempt to solve this macabre wildlife whodunit. Nat Geo Wild :
  • Mammalian Dive Reflex This morning, we learned about some of the seal's amazing adaptations. We learned about the mammalian dive reflex. Here's a short movie of the experiment we did.
  • Fertilisation of Mammalian Gametes This video outlines how a sperm fertilises an egg.
  • How to split mammalian cells Procedure for splitting mammalian cells. And some music too...
  • Neural Plasticity and Diversity in the Adult Mammalian Brain Air date: Thursday, March 17, 2011, 3:00:00 PM Timedisplayed is Eastern Time, Washington DC Local Category: Wednesday Afternoon Lectures Description: The first part of the talk will focus on evidence supporting the birth and maturation of new neurons in the adult dentate gyrus of the hippocampus in the mammalian brain. The mechanism by which the cells integrate and become functional will be discussed. In addition, the potential functional significance for adult neurogenesis in the context of the normal function of the hippocampus will be discussed. In the second part of the talk I will focus on the recent finding that LINE-1 (Long Interspersed Nucleotide Elements-1 or L1) retroelements are active in somatic neuronal progenitor cells (NPCs) providing an additional mechanism for neuronal diversification. Together with their mutated relatives, retroelement sequences constitute 45% of the mammalian genome with L1 elements alone representing 20%. The fact that L1 can retrotranspose in a defined window of neuronal differentiation, changing the genetic information in single neurons in an arbitrary fashion, allows the brain to develop in distinctly different ways. This characteristic of variety and flexibility may contribute to the uniqueness of an individual brain. However, the molecular mechanism that regulates L1 expression in NPCs is not completely understood. L1s are likely silenced in neural stem cells due to Sox2-mediated transcription repression. Down-regulation of Sox2 ...
  • Mammals Check us out at Mammals (formally Mammalia) are a class of vertebrate, air-breathing animals whose females are characterized by the possession of mammary glands while both males and females are characterized by sweat glands, hair and/or fur, three middle ear bones used in hearing, and a neocortex region in the brain. Mammals are divided into three main infraclass taxa depending how they are born. These taxa are: monotremes, marsupials and placentals. Except for the five species of monotremes (which lay eggs), all mammal species give birth to live young. Most mammals also possess specialized teeth, and the largest group of mammals, the placentals, use a placenta during gestation. The mammalian brain regulates endothermic and circulatory systems, including a four-chambered heart. There are approximately 5400 species of mammals, distributed in about 1200 genera, 153 families, and 29 orders(though this varies by classification scheme). Mammals range in size from the 3040 millimeter (1- to 1.5-inch) Bumblebee Bat to the 33-meter (108-foot) Blue Whale. Mammals are divided into two subclasses: the Prototheria, which includes the oviparous monotremes, and the Theria, which includes the placentals and live-bearing marsupials. Most mammals, including the six largest orders, belong to the placental group. The three largest orders, in descending order, are Rodentia (mice, rats, porcupines, beavers, capybaras, and other gnawing mammals), Chiroptera (bats), and ...
  • Mammals Vs. Dinos- Mammalian Neocortex On the Science Channel's "Mammals vs. Dinos," development of the neocortex enabled early mammals to ***yze, differentiate, and react to sound. Ability to react to sound, enabled mammals to survive and thrive at night.
  • Problems with Noah's Ark: Mammalian Megafauna This video, my first, concerns the colourful fable of Noah's Ark that many people in the 21st century still believe to be the literal retelling of a historical event. Although the story has been debunked so often that there remains barely a shekel's worth of credibility to it, I thought it might be interesting to tackle the subject from a new angle. By looking at the mammal "megafauna" that roamed the earth for tens of millions of years after the dinosaur age, I hope to add yet another layer of "discussion" to this curious tale of godly wrath, genocide, and inbreeding-to-be. Apologies ahead of time for my voice. Never heard it before in this format, and Orson Welles I am not! For more on Noah's Ark, see the following stellar videos: TheThinkingAtheist: ebolaworld: AntiCitizenX: PotHoler54: DonExodus2: DarkMatter2525:
  • New Fossil Solves Puzzle of Mammalian Evolution Paleontologists from the American Museum of Natural History and the Chinese Academy of Sciences announce the discovery of Liaoconodon hui, a complete fossil mammal from the Mesozoic found in China that includes the long-sought transitional middle ear.
  • Croc Hunter - Mammalian Breath Hold Techniques For my college marine bio class, pretty sweet.
  • Abbe May -- Mammalian Locomotion(Kevin Parker & Cam Avery Remix) Tame Impala Remix
  • Quick Change - Episode Seven - Mammalian Diving Reflex Host Wayne MacPhail interviews the founder of the Mammalian Diving Reflex, Darren O'Donnell about the art/research atelier's work in mashing together chunks of society that normally don't mesh.
  • Mammalian - RPFF 2011 Teaser More films and World Tour Schedule at Mammalian Duration 63 min Year Produced: 2010 • Year Released: 2010 A 2000-kilometer arctic canoe journey from Yellowknife to Rankin Inlet provides the setting for this intimate, sideways look at the largest wilderness area in North America. From the deepest heart of the barrenlands, the filmmakers have emerged with a compelling portrait of the landscape and a shocking new discovery. Director and Producer: Frank Wolf Website: www.mammalian-
  • Drying of wet mammals by body oscillation From "The Wet-Dog Shake," Andrew Dickerson, Grant Mills, Jay Bauman, Young-Hui Chang, David Hu, published in ArXiv, 15 Oct 2010: Abstract: The drying of wet fur is a critical to mammalian heat regulation. In this fluid dynamics video, we show a sequence of films demonstrating how hirsute animals to rapidly oscillate their bodies to shed water droplets, nature's ***ogy to the spin cycle of a washing machine. High-speed videography and fur-particle tracking is employed to determine the angular position of the animal's shoulder skin as a function of time. X-ray cinematography is used to track the motion of the skeleton. We determine conditions for drop ejection by considering the balance of surface tension and centripetal forces on drops adhering to the animal. Particular attention is paid to rationalizing the relationship between animal size and oscillation frequency required to self-dry.
  • Children with ADD / ADHD / Autism benefit from mammalian omega 3 www.auumomega3 Clinical studies revealed that non-verbal children with autism began to speak after 6 week trial on Auum Omega 3 Sublingual-D. The health benefits and overall balance that comes from feeding the brain mammalian omega 3s and vitamin D are truly life-changing for children with special needs.
  • MAMMALIAN SKIN // GOODWIN SANDS // TIME WELL SPENT EP In July 2010 Goodwin Sands recorded their second EP in Antwerpen, Belgium. "Time Well Spent" features five new songs and is available here for free download. All songs by Goodwins Sands. Recorded by , Antwerp. Mastered by Barry Gardner at Safe and Soundmastering, London. Coverart by Laura Fitzgerald. Video directed, recorded and edited by Bram Kok and Vincent Perdijk.
  • BrainNavigator's Mammalian Brain Ontology Seminar-Part V of V The Puelles Mammalian Brain Ontology Seminar (November 2010) Presented by Charles Watson and George Paxinos. Hosted by Elsevier Inc., creators of BrainNavigator software, an interactive atlas and 3D brain software for research, structure, ***ysis, and education. /info
  • Biolog Expands to Mammalian Cell Biology Biolog's John Pietrzyk provides information about the company's background and metabolic technology at this year's LabAutomation 2010.
  • Highway Of Life: The Ancestors Of All Mammals Science & Reason on Facebook: Evolution (Part 3): Highway of Life (Episode 2): The ancestors of all mammals --- Please subscribe to Science & Reason: • • • • --- The evolution of mammals within the synapsid lineage (mammal-like-reptiles) was a gradual process that took approximately 70 million years, beginning in the mid-Permian. By the mid-Triassic, there were many species that looked like mammals, and the first true mammals appeared in the early Jurassic. The earliest known marsupial, Sinodelphys, appeared 125 million years ago in the early Cretaceous, around the same time as Eomaia, the first known eutherian (member of placentals' "parent" group); and the earliest known monotreme, Teinolophos, appeared two million years later. After the Cretaceous-Tertiary extinction wiped out the non-avian dinosaurs (birds are generally regarded as the surviving dinosaurs) and several other mammalian groups, placental and marsupial mammals diversified into many new forms and ecological niches throughout the Tertiary, by the end of which all modern orders had appeared. From the point of view of phylogenetic nomenclature, mammals are the only surviving synapsids. The synapsid lineage became distinct from the sauropsid ("reptile") lineage in the late Carboniferous period, between 320 and 315 million years ago, and were the most common and largest land vertebrates of the Permian period. But in the Triassic period ...
  • The Evolution of Mammals and their Extinct Relatives American Museum of Natural History 4th floor, film on mammalian evolution by primitive mammals section. Pics on /amnh4
  • Mammals Vs. Dinos- Mammalian Sensory Development On the Science Channel's "Mammals vs. Dinos," night time was the right time for mammals during the age of dinosaurs. Their nocturnal abilities to hunt and feed protected mammals from their predators and lead to further development of their ears.
  • Mammalian Action Potential at a Node of Ranvier Simulation of ion channel behavior at a mammalian node of ranvier during an action potential. Membrane voltage from Hodgkin & Huxley model according to Awiszus, Biological Cybernetics,67: 427-432 (1992). Individual ion channel dynamics from poisson distributed markov model (Hille 2001)
  • The Mammalian Urogenital System Urogenital system of the cat (and rabbit)
  • The Cellular Structure of the Mammalian Brain Part 1 of 3 The cellular structure of the mammalian brain and spinal cord have been completely revised. There are only neurons in a neurological syncytium. There are no neuroglial cells. Made by Harold Hillman and Nita Spektorov in 1986.
  • Mammalian Film Trailer Buy DVD of full film at www.mammalian- Trailer for the upcoming film 'Mammalian' that takes an intimate, sideways look at the largest wilderness area in North America from the perspective of a 2000 km canoe journey from Yellowknife to Rankin Inlet. Through interviews with the remote local inhabitants and through their own experience, Frank Wolf and Taku Hokoyama bring to light the issues that face this vast landscape. See more at www.frank-
  • Regulatory and Epigenetic Landscapes of Mammalian Genomes (2010) February 23, 2010. Laura Elnitski, Ph.D. Current Topics in Genome ***ysis 2010 Handout: www.genome.gov More: www.genome.gov
  • Abbe May - 'Mammalian Locomotion' Live at The Grace Emily, Adelaide ( Wed 29 Aug) Abbe May performing 'Mammalian Locomotion' at The Grace Emily, Adelaide.
  • ABBE MAY - MAMMALIAN LOCOMOTION Purchase song at First single from the album "Design Desire".. Directed by Zena Loxton. Edited by: Matt Kitchin Styling and Casting by Jillian King. Dancers - Ciarah Hayes, Tanya Vale, Tiffanie Salisbury.
  • Large-Scale Model of Mammalian Thalamocortical Systems Original located at: vesicle.nsi.edu rotating brain showing spontaneous spiking activity Eugene M. Izhikevich and Gerald M. Edelman The Neurosciences Institute, 10640 John Jay Hopkins Drive, San Diego, CA, 92121. Also read the article here:
  • Mammals Vs. Dinos- Early Mammalian Life Span On the Science Channel's "Mammals vs. Dinos," comparisons are made between the lifespan of dinosaurs and mammals during the Cretaceous. Mammals had much shorter life spans, but reproduced rapidly giving them the evolutionary edge over dinosaurs.
  • Mammals Vs. Dinos- Mammalian Ear Evolution On the Science Channel's "Mammals vs. Dinos," even though mammals remained small during the age of the dinosaur, they began to thrive with the development of the ear ossicles. Development of the senses helped mammals survive particularly at night.
  • Eevee is a mammalian creature with brown fur Eevee is a mammalian creature with brown fur, a bushy tail that has a cream-colored tip, and a furry collar that is also cream-colored. Eevee has brown eyes and big ears. It has traits of raccoons, foxes, dogs, and cats. Eevee has an irregular genetic code and can sometimes evolve in accordance to its environment. Seven evolutions for this Pokémon have been discovered so far. Three of these evolutions are the result of Eevee being exposed to either a Fire Stone, Thunder Stone or Water Stone. Type: Normal Species: Evolution Pokémon Exp. at 100: 1000000 Special Abilities: Adaptability, Running Away, and Pissing Everyone-off :3 music: ott - roflcopter
  • The Cellular Structure of the Mammalian Brain Part 2 of 3 The cellular structure of the mammalian brain and spinal cord have been completely revised. There are only neurons in a neurological syncytium. There are no neuroglial cells. Made by Harold Hillman and Nita Spektorov in 1986.
  • BrainNavigator's Mammalian Brain Ontology Seminar-Part II of V The Puelles Mammalian Brain Ontology Seminar (November 2010) Presented by Charles Watson and George Paxinos. Hosted by Elsevier Inc., creators of BrainNavigator software, an interactive atlas and 3D brain software for research, structure, ***ysis, and education. /info

Blogs & Forum
blogs and forums about mammalian

  • “http://www.scienceda 00809142044.htm Scientists Map All Mammalian Gene Interactions The findings, published in the August issue of the journal”
    — Scientists Map All Mammalian Gene Interactions - ,

  • “The Basel Forum on Biosafety 1993 will survey applications of mammalian cell cultures and the possible hazards related to adventitious agents”
    — BATS: Biosafety of Mammalian Cell Cultures, bats.ch

  • “Trehalose Stabilization of Dry Mammalian Cells The Center for Biostabilization at UC Davis is attempting to stabilize mammalian cells in the dry state”
    — Trehalose Stabilization of Dry Mammalian Cells,

  • “Novel Theory for Mammalian Stem Cell Regulation. Novel Theory for Mammalian Stem Cell Regulation. Friday, 29 January 2010. Linheng Li, Ph.D. published today by the journal Science that proposes a new model of mammalian adult stem cell regulation”
    — CellNEWS: Novel Theory for Mammalian Stem Cell Regulation, cellnews-

  • “balint at spench fullstop-decimalpoint-dot net”
    Mammalian — Balint's Blog,

  • “Your use of this forum indicates your agreement to our terms of use. [ Log In] Science a GoGo's Home Page " Forums " General Discussion " General Science Discussion Forum " Role of ROS in mammalian longevity”
    — Role of ROS in mammalian longevity - Science a GoGo's,

  • “The Chinese Golden Snub-Nosed Monkey When 2010 was first made the Year of Biodiversity, who would have known that such a wealth of knowledge into the lives of other animals would come to light. Thousands of new species were discovered last year”
    — New Mammalian Discoveries - Betty the Butterfly's Blog - A-Z, a-z-

  • “Mammalian 'disorderly' proteins - From ”
    Mammalian 'disorderly' proteins, biology-

  • “MicroRNAs (miRNAs) are endogenous ~22-nucleotide RNAs that mediate important gene-regulatory events by pairing to the mRNAs of protein-coding genes to direct their repression”
    Mammalian microRNAs predominantly act to decrease target mRNA,

Similar
similar for mammalian